Invitrogen antibodies—maximize lab budgets with advanced validation & coverage

Shop antibodies

Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
  • Special Offers
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

SNP Genotyping
  • Search All
  • Popular Product Areas
  • TaqMan Assays
  • Gene Expression
  • Microbe & ABR Detection
  • Copy Number Variation
  • Mutation Detection
  • miRNA
  • SNP Genotyping
  • Primary Antibodies
  • Secondary Antibodies
  • Isotype Controls
  • Proteins & Peptides
  • ELISA Kits
  • All Documents & Support
  • Certificates
  • SDS
  • Manuals & Protocols
  • Product FAQs
    Search button Close
            • Order Status
            • Quick Order
            • Sign in
              Sign in
              Don't have an account ? Create Account
              • Account
              • Check Order Status
              • Aspire Member Program
              • Connect: Lab, Data, Apps
              • Custom Products & Projects
              • Services Central
            This product has been added to your favorites list. Go to My Favorites

            System Message

            OKCancel
            LOADING ...
            • Home
            • › Search Tool
            • › Search Results
            • › C__25625805_10
            See other CYP2C9 GT Assays ›
            SNP ID:
            rs1799853
            Gene
            CYP2C9
            Gene Name
            cytochrome P450 family 2 subfamily C member 9
            Set Membership:
            > HapMap > DME > Validated > Inventoried
            Chromosome Location:
            Chr.10: 94942290 - 94942290 on Build GRCh38
            Polymorphism:
            C/T, Transition substitution
            Context Sequence [VIC/FAM]:

            GATGGGGAAGAGGAGCATTGAGGAC[C/T]GTGTTCAAGAGGAAGCCCGCTGCCT

            Assay ID C__25625805_10
            Size 150 rxns
            Availability Inventoried
            Catalog # 4362691
            Price (USD) 572.00
            Your Price
            Online offer (USD):526.65
            526.65
            Check your price ›
            • Genomic Map
            • Assay Details
            • More Information

            Genomic Map

            LOADING... Fetching data..
            ×
            Back To Top

            Assay Details



            Species:

            Human

            dbSNP Submissions:

            NA

            Phenotype:

            MIM: 601130

            Literature Links:

            CYP2C9 PubMed Links

            Allele Nomenclature:

            CYP2C9*2A,c.430C>T CYP2C9*2A,g.3608C>T CYP2C9*2B,c.430C>T CYP2C9*2B,g.3608C>T CYP2C9*2C,c.430C>T CYP2C9*2C,g.3608C>T

            Minor Allele Frequency:

            1000Genome Applied Biosystems® HapMap
            Global
            T (0.05)
            (0.95)
            Caucasian
            T (0.17)
            (0.83)
            CEPH (CEU)
            T (0.10)
            (0.90)
            EAS
            T (0.00)
            (1.00)
            African American
            T (0.02)
            (0.98)
            YRI (Yoruba) - Not Available
            SAS
            T (0.04)
            (0.96)
            Japanese
            T (0.00)
            (1.00)
            CHB (Han Chinese) - Not Available
            AFR
            T (0.01)
            (0.99)
            Chinese
            T (0.00)
            (1.00)
            JPT (Japanese) - Not Available
            EUR
            T (0.12)
            (0.88)
            AMR
            T (0.10)
            (0.90)
            CYP2C9 - cytochrome P450 family 2 subfamily C member 9
            Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
            NM_000771.3 455 Missense Mutation CGT,TGT R,C 144 NP_000762.2
            XM_017015758.1 455 Missense Mutation CGT,TGT R,C 144 XP_016871247.1

            Back To Top

            More Information


            Set Membership:

            HapMap DME Validated Inventoried

            Panther Classification:

            Molecular Function -

            oxidoreductase oxygenase metabolite interconversion enzyme

            Gene Ontology Categories:

            Function(s) Process(es)

            xenobiotic metabolic process
            steroid metabolic process
            monoterpenoid metabolic process
            drug metabolic process
            epoxygenase P450 pathway
            urea metabolic process
            monocarboxylic acid metabolic process
            drug catabolic process
            exogenous drug catabolic process
            cellular amide metabolic process
            oxidation-reduction process
            oxidative demethylation
            omega-hydroxylase P450 pathway
            cholesterol 25-hydroxylase activity
            monooxygenase activity
            iron ion binding
            drug binding
            arachidonic acid epoxygenase activity
            steroid hydroxylase activity
            oxidoreductase activity
            (S)-limonene 6-monooxygenase activity
            (S)-limonene 7-monooxygenase activity
            oxygen binding
            heme binding
            caffeine oxidase activity
            (R)-limonene 6-monooxygenase activity

            Back To Top

            Related Products

            • TaqMan® Genotyping Master Mix
            Ordering Plus Icon Minus Icon
            • Order Status
            • Order Help
            • Quick Order
            • Supply Center
            • eProcurement
            Support Plus Icon Minus Icon
            • Help and Support
            • Contact Us
            • Technical Support Centers
            • Documents and Certificates
            • Report a Site Issue
            Resources Plus Icon Minus Icon
            • Learning Centers
            • Promotions
            • Events and Webinars
            • Social Media
            About Thermo Fisher Plus Icon Minus Icon
            • About Us
            • Careers
            • Investors
            • News
            • Social Responsibility
            • Trademarks
            • Consumer Health Data Privacy Policy
            Our Portfolio Plus Icon Minus Icon
            • Thermo Scientific
            • Applied Biosystems
            • Invitrogen
            • Gibco
            • Ion Torrent
            • Fisher Scientific
            • Unity Lab Services
            • Patheon
            • PPD
            • Terms & Conditions
            • Privacy Information Center
            • Price & Freight Policy
            • Cookie Preferences

              Your choices regarding cookies on this site

              We and our affiliates and vendors use cookies and similar technologies to operate our sites, recognize visitors to our sites, provide secure log-in, collect statistics to optimize site functionality, and deliver content tailored to your interests. Click Accept All to accept all cookies and go directly to the site, click Reject All to reject all but cookies strictly necessary to the functioning of this site (required cookies), or click on Manage Settings to see detailed descriptions of the types of cookies and choose whether to accept certain cookies while on the site.
            © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
            United States flag icon
            United States

            Your items have has been added!


            Host server : magellan-search-green-6ff95d844f-rcq5x:80/100.66.72.122:80.
            git-commit: f44aa9153aef922f8fad9a05e87b8aee811da128
            git-url: https://github.com/thermofisher/magellan-search
            git-branch: release/2.28.0-Offline