Custom TaqMan™ SNP Genotyping Assay, non-human
Applied Biosystems™

Custom TaqMan™ SNP Genotyping Assay, non-human

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5'‐nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNARead more
Have Questions?
Change viewbuttonViewtableView
Catalog NumberQuantity
4332076L (2400 reactions), made to order
4332075M (1000 reactions), made to order
4332077S (300 reactions), made to order
Catalog number 4332076
Price (USD)
1,409.65
Online Exclusive
1,584.00
Save 174.35 (11%)
Each
Quantity:
L (2400 reactions), made to order

Applied Biosystems TaqMan SNP Genotyping Assays use TaqMan 5'‐nuclease chemistry to amplify and detect specific polymorphisms in purified genomic DNA samples. Each assay enables genotyping of individuals for a single nucleotide polymorphism (SNP) and consists of two sequence-specific primers and two TaqMan minor groove binder (MGB) probes with non-fluorescent quenchers (NFQ). One probe is labeled with VIC dye to detect the Allele 1 sequence; the second probe is labeled with FAM dye to detect the Allele 2 sequence.

Custom TaqMan SNP Genotyping Assays can be easily designed at no extra charge by submitting target sequences confidentially to our secure Custom Assay Design Tool. The tool can generate assay designs targeting any SNP in any organism, offering maximum flexibility to meet your research needs.

Benefits:

  • Proven—gold-standard TaqMan chemistry and robust assay designs deliver accurate, reproducible, and reliable results
  • Easy—convenient single-tube format and simple workflow provide an easy path to trusted results; no optimization required
  • Flexible—obtain assay designs for any SNP in any organism using our secure Custom Assay Design Tool, at no extra charge
  • Tested—all custom assays are quality-control tested for synthesis accuracy and formulation completeness

Approximate ship time

4–6 days in North America and 6–10 days in Europe

The free Custom Assay Design Tool can generate assays for the detection of SNPs, MNPs, and indels of up to six bases. These custom assays are designed, synthesized, formulated, optimized, and quality control tested.

TaqMan SNP Genotyping Assays require only three reaction components for PCR: purified genomic DNA (1–20 ng), the assay solution, and TaqMan Genotyping Master Mix (or another compatible master mix) (sold separately).

All assay designs are the product of our industry-leading bioinformatics pipeline, optimized over the course of more than a decade by leveraging manufacturing and assay performance data. TaqMan Assays have been cited in over 40,000 publications and are backed by more than 350 patents.

Recommended master mix (sold separately): TaqMan Genotyping Master Mix (Cat. No. 4371355)

For Research Use Only. Not for use in diagnostic procedures.
Specifications
Concentration80X
For Use With (Equipment)7500 System, 7500 Fast System, 7900HT System, StepOne™, StepOnePlus™, ViiA™ 7 System, QuantStudio™ Absolute Q Digital PCR System, QuantStudio™ 3, QuantStudio™ 5, QuantStudio™ 6 Flex, QuantStudio™ 7 Flex, QuantStudio 6 Pro, QuantStudio 7 Pro, QuantStudio™ 12k Flex ProFlex PCR System*, VeritiPro*, SimpliAmp*, MiniAmp*, Automated Thermal Cycler** If a thermal cycler is used for PCR amplification, the optional pre-read and the post-read must be performed separately on a real-time PCR system in order to detect and record fluorescent signals.
No. of Reactions12,000 (384-well), 2400 (96-well)
Product LineTaqMan
QuantityL (2400 reactions), made to order
Shipping ConditionRoom Temperature
Sample TypeNon-human
Unit SizeEach
Contents & Storage
1 tube containing a 40X (S and M sizes) or 80X (L size) mix of pre-formulated assay (2 probes and 2 primers).

Store at -15 to -25°C.

Frequently asked questions (FAQs)

How much gDNA should I use with my TaqMan SNP Genotyping Assay?

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

How do I submit a sequence for a custom TaqMan SNP Genotyping Assay?

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay. The DNA sequence needs to have at least 30 bases on each side of the SNP site. The more sequence you provide, the greater chance you have of the tool creating a passing design. The ideal sequence length is ~ 200 bases on either side of the SNP site. For the best-performing assay, we recommend prescreening the sequence for other SNPs, repeats, and regions of low complexity. These variations should be masked prior to submitting the sequence. This will prevent the design tool from designing the primers or probe over those regions, which could reduce the efficiency of the assay if they were used. For more details on how to screen and mask the sequence, please follow the guidelines here (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf).

How should I dilute the TaqMan SNP Genotyping Assays?

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).