1x1 image pixel for data collection
T7 promoter Sequencing Primer, 20-mer
This product is being discontinued effective 30 September 2025. Please contact your local sales reptesentative or our customer care teams for additional assistance.
T7 promoter Sequencing Primer, 20-mer
Thermo Scientific™

T7 promoter Sequencing Primer, 20-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to theRead more
Have Questions?
Catalog NumberQuantity
SO11810 μM
Catalog number SO118
Price (USD)
104.00
10 µM
Estimated availability date 28-Jul-2025
Add to cart
Quantity:
10 μM
Price (USD)
104.00
10 µM
Add to cart

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'

Related products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

For Research Use Only. Not for use in diagnostic procedures.
Specifications
For Use With (Application)Sequencing
FormLiquid
Product TypeSequencing Primer
Quantity10 μM
Shipping ConditionDry Ice
VectorpTZ19R, pTZ57R, pBluescript II
Concentration10 μM
PrimerT7
PromoterSP6, T3, T7
Unit Size10 µM
Contents & Storage
T7 promoter Sequencing Primer, 20-mer, 10 μM

Store at –20°C.

Documents & Downloads

Certificates

Safety Data Sheets

Share catalog number, name or link

1x1 image pixel for data collection