Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
Catalog Number | Unit Size | Price (EUR) | Availability | Quantity | |
---|---|---|---|---|---|
SO118 | 10 µM | 41,46 Online price 48,21 | - |
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'
Related products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.