Invitrogen antibodies—maximize lab budgets with advanced validation & coverage

Shop antibodies

Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

Mutation Detection
  • Search All
  • Popular Product Areas
  • TaqMan Assays
  • Gene Expression
  • Microbe & ABR Detection
  • Copy Number Variation
  • Mutation Detection
  • miRNA
  • SNP Genotyping
  • Primary Antibodies
  • Secondary Antibodies
  • Isotype Controls
  • Proteins & Peptides
  • ELISA Kits
  • All Documents & Support
  • Certificates
  • SDS
  • Manuals & Protocols
  • Product FAQs
    Search button Close
            • Order Status
            • Quick Order
            • Sign in
              Sign in
              Don't have an account ? Create Account
              • Account
              • Check Order Status
              • Aspire Member Program
              • Connect: Lab, Data, Apps
              • Custom Products & Projects
              • Services Central
            This product has been added to your favorites list. Go to My Favorites

            System Message

            OKCancel
            LOADING ...
            • Home
            • ›
            • Digital PCR
            • › Search Tool
            • › Search Results
            • › Hs000000003_rm
            See other BRAF DPCR Assay's ›
            Gene:
            BRAF
            Transcript:
            ENST00000288602.0
            Assay Name:
            BRAF_475
            COSMIC ID:
            475
            Nucleotide Mutation:
            c.1799_1800TG>AA
            Amino Acid Change
            p.V600E
            Mutation genome location:
            chr.7 140753335-140753336 on build GRCh38
            Assay gene location:
            Overlaps Intron 15 - Exon 16
            Context Sequence [VIC/FAM]:

            ATGGGACCCACTCCATCGAGATTT[CA/TT]CTGTAGCTAGACCAAAATCACCTA

            Assay ID Hs000000003_rm
            Size S: 450 rxns
            Availability Made To Order
            Catalog # A44177
            Price
            Your Price
            Online offer:
            Check your price ›
            • Genomic Map

            Genomic Map

            LOADING... Fetching data.
            ×
            Back To Top

            More Information


            Set Membership:

            Coding - Overlap Exon/Intron

            Panther Classification:

            Molecular Function -

            kinase non-receptor serine/threonine protein kinase non-receptor tyrosine protein kinase protein kinase transferase

            Gene Ontology Categories:

            Function(s) Process(es)

            MAPK cascade
            activation of MAPKK activity
            myeloid progenitor cell differentiation
            protein phosphorylation
            visual learning
            organ morphogenesis
            positive regulation of gene expression
            negative regulation of fibroblast migration
            glucose transport
            thyroid gland development
            positive regulation of peptidyl-serine phosphorylation
            somatic stem cell population maintenance
            cellular response to drug
            regulation of cell proliferation
            negative regulation of apoptotic process
            CD4-positive, alpha-beta T cell differentiation
            positive T cell selection
            response to peptide hormone
            negative regulation of neuron apoptotic process
            thymus development
            positive regulation of axon regeneration
            positive regulation of axonogenesis
            protein heterooligomerization
            positive regulation of stress fiber assembly
            response to cAMP
            long-term synaptic potentiation
            head morphogenesis
            face development
            positive regulation of ERK1 and ERK2 cascade
            cellular response to calcium ion
            establishment of protein localization to membrane
            positive regulation of substrate adhesion-dependent cell spreading
            negative regulation of synaptic vesicle exocytosis
            negative regulation of endothelial cell apoptotic process
            protein kinase activity
            protein serine/threonine kinase activity
            MAP kinase kinase kinase activity
            calcium ion binding
            protein binding
            ATP binding
            small GTPase binding
            mitogen-activated protein kinase kinase binding
            identical protein binding
            protein heterodimerization activity

            Back To Top

            Related Products

            • TaqMan® Digital PCR Chip Kit
            • TaqMan® Digital PCR Master Mix
            Ordering Plus Icon Minus Icon
            • Order Status
            • Order Help
            • Quick Order
            • Supply Center
            • eProcurement
            Support Plus Icon Minus Icon
            • Help and Support
            • Contact Us
            • Technical Support Centers
            • Documents and Certificates
            • Report a Site Issue
            Resources Plus Icon Minus Icon
            • Learning Centers
            • Promotions
            • Events and Webinars
            • Social Media
            About Thermo Fisher Plus Icon Minus Icon
            • About Us
            • Careers
            • Investors
            • News
            • Social Responsibility
            • Trademarks
            • Consumer Health Data Privacy Policy
            Our Portfolio Plus Icon Minus Icon
            • Thermo Scientific
            • Applied Biosystems
            • Invitrogen
            • Gibco
            • Ion Torrent
            • Fisher Scientific
            • Unity Lab Services
            • Patheon
            • PPD
            • Terms & Conditions
            • Privacy Information Center
            • Price & Freight Policy
            • Cookie Preferences

              Your choices regarding cookies on this site

              We and our affiliates and vendors use cookies and similar technologies to operate our sites, recognize visitors to our sites, provide secure log-in, collect statistics to optimize site functionality, and deliver content tailored to your interests. Click Accept All to accept all cookies and go directly to the site, click Reject All to reject all but cookies strictly necessary to the functioning of this site (required cookies), or click on Manage Settings to see detailed descriptions of the types of cookies and choose whether to accept certain cookies while on the site.
            © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
            united states flag icon
            United States

            Your items have has been added!


            Host server : magellan-search-green-6ff95d844f-sbk6v:80/100.66.72.122:80.
            git-commit: f44aa9153aef922f8fad9a05e87b8aee811da128
            git-url: https://github.com/thermofisher/magellan-search
            git-branch: release/2.28.0-Offline