Transform your discoveries into market-ready therapies

Biotech solutions

Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

Search All
  • Search All
  • Popular Product Areas
  • TaqMan Assays
  • Gene Expression
  • Microbe & ABR Detection
  • Copy Number Variation
  • Mutation Detection
  • miRNA
  • SNP Genotyping
  • Primary Antibodies
  • Secondary Antibodies
  • Isotype Controls
  • Proteins & Peptides
  • ELISA Kits
  • All Documents & Support
  • Certificates
  • SDS
  • Manuals & Protocols
  • Product FAQs
    Search button Close
            • Order Status
            • Quick Order
            • Sign in
              Sign in
              Don't have an account ? Create Account
              • Account
              • Check Order Status
              • Aspire Member Program
              • Connect: Lab, Data, Apps
              • Custom Products & Projects
              • Services Central
            This product has been added to your favorites list. Go to My Favorites

            System Message

            OKCancel
            LOADING ...
            • Home
            • › Search Tool
            • › Search Results
            • › C____904973_10
            See other APOC1 GT Assays ›
            SNP ID:
            rs7412
            Gene
            APOC1 APOE TOMM40
            Gene Name
            apolipoprotein C1
            apolipoprotein E
            translocase of outer mitochondrial membrane 40
            Set Membership:
            > HapMap > Validated
            Chromosome Location:
            Chr.19: 44908822 - 44908822 on Build GRCh38
            Polymorphism:
            C/T, Transition substitution
            Context Sequence [VIC/FAM]:

            CCGCGATGCCGATGACCTGCAGAAG[C/T]GCCTGGCAGTGTACCAGGCCGGGGC

            Assay ID C____904973_10
            Size
            Availability Made To Order
            Catalog # 4351379
            Price (USD) 442.00
            Your Price
            Online offer (USD):407.65
            407.65
            Check your price ›
            • Genomic Map
            • Assay Details
            • More Information

            Genomic Map

            LOADING... Fetching data...
            ×
            Back To Top

            Assay Details



            Species:

            Human

            dbSNP Submissions:

            NA

            Phenotype:

            MIM: 107710 MIM: 107741 MIM: 608061

            Literature Links:

            APOC1 PubMed Links

            Allele Nomenclature:

            Minor Allele Frequency:

            1000Genome Applied Biosystems® HapMap
            Global
            T (0.08)
            (0.92)
            Caucasian
            T (0.02)
            (0.98)
            CEPH (CEU) - Not Available
            EAS
            T (0.10)
            (0.90)
            African American
            T (0.13)
            (0.87)
            YRI (Yoruba)
            T (0.10)
            (0.90)
            SAS
            T (0.04)
            (0.96)
            Japanese
            T (0.10)
            (0.90)
            JPT (Japanese)
            T (0.05)
            (0.95)
            AFR
            T (0.10)
            (0.90)
            Chinese
            T (0.07)
            (0.93)
            CHB (Han Chinese)
            T (0.10)
            (0.90)
            EUR
            T (0.06)
            (0.94)
            AMR
            T (0.05)
            (0.95)
            APOC1 - apolipoprotein C1
            There are no transcripts associated with this gene.
            APOE - apolipoprotein E
            Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
            NM_000041.3 724 Missense Mutation CGC,TGC R,C 176 NP_000032.1
            NM_001302688.1 724 Missense Mutation CGC,TGC R,C 202 NP_001289617.1
            NM_001302689.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289618.1
            NM_001302690.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289619.1
            NM_001302691.1 724 Missense Mutation CGC,TGC R,C 176 NP_001289620.1
            TOMM40 - translocase of outer mitochondrial membrane 40
            There are no transcripts associated with this gene.

            Back To Top

            More Information


            Set Membership:

            HapMap Validated

            Panther Classification:

            Molecular Function -

            apolipoprotein

            Gene Ontology Categories:

            Function(s) Process(es)

            response to reactive oxygen species
            retinoid metabolic process
            negative regulation of endothelial cell proliferation
            response to dietary excess
            triglyceride metabolic process
            cholesterol catabolic process
            cellular calcium ion homeostasis
            receptor-mediated endocytosis
            cytoskeleton organization
            G-protein coupled receptor signaling pathway
            nitric oxide mediated signal transduction
            synaptic transmission, cholinergic
            cholesterol metabolic process
            regulation of gene expression
            negative regulation of platelet activation
            positive regulation of cholesterol esterification
            positive regulation of cholesterol efflux
            long-chain fatty acid transport
            protein import
            virion assembly
            triglyceride catabolic process
            cGMP-mediated signaling
            negative regulation of blood coagulation
            regulation of axon extension
            positive regulation of cGMP biosynthetic process
            neuron projection regeneration
            regulation of Cdc42 protein signal transduction
            positive regulation of low-density lipoprotein particle receptor catabolic process
            cholesterol efflux
            phospholipid efflux
            very-low-density lipoprotein particle remodeling
            low-density lipoprotein particle remodeling
            high-density lipoprotein particle remodeling
            high-density lipoprotein particle assembly
            chylomicron remnant clearance
            high-density lipoprotein particle clearance
            very-low-density lipoprotein particle clearance
            lipoprotein metabolic process
            lipoprotein biosynthetic process
            lipoprotein catabolic process
            vasodilation
            cholesterol homeostasis
            negative regulation of MAP kinase activity
            negative regulation of neuron apoptotic process
            negative regulation of blood vessel endothelial cell migration
            reverse cholesterol transport
            positive regulation by host of viral process
            negative regulation of cholesterol biosynthetic process
            positive regulation of lipid biosynthetic process
            intracellular transport
            regulation of neuronal synaptic plasticity
            artery morphogenesis
            negative regulation of inflammatory response
            positive regulation of nitric-oxide synthase activity
            positive regulation of membrane protein ectodomain proteolysis
            maintenance of location in cell
            fatty acid homeostasis
            positive regulation of dendritic spine development
            negative regulation of canonical Wnt signaling pathway
            AMPA glutamate receptor clustering
            NMDA glutamate receptor clustering
            cellular oxidant detoxification
            regulation of beta-amyloid clearance
            negative regulation of neuron death
            positive regulation of postsynaptic membrane organization
            negative regulation of presynaptic membrane organization
            negative regulation of beta-amyloid formation
            positive regulation of dendritic spine maintenance
            positive regulation of phospholipid efflux
            positive regulation of lipid transport across blood brain barrier
            beta-amyloid binding
            lipid transporter activity
            protein binding
            phospholipid binding
            heparin binding
            lipid binding
            cholesterol binding
            antioxidant activity
            cholesterol transporter activity
            identical protein binding
            protein homodimerization activity
            metal chelating activity
            tau protein binding
            low-density lipoprotein particle receptor binding
            phosphatidylcholine-sterol O-acyltransferase activator activity
            very-low-density lipoprotein particle receptor binding
            lipoprotein particle binding

            Back To Top

            Related Products

            • TaqMan® Genotyping Master Mix
            Ordering Plus Icon Minus Icon
            • Order Status
            • Order Help
            • Quick Order
            • Supply Center
            • eProcurement
            Support Plus Icon Minus Icon
            • Help and Support
            • Contact Us
            • Technical Support Centers
            • Documents and Certificates
            • Report a Site Issue
            Resources Plus Icon Minus Icon
            • Learning Centers
            • Promotions
            • Events and Webinars
            • Social Media
            About Thermo Fisher Plus Icon Minus Icon
            • About Us
            • Careers
            • Investors
            • News
            • Social Responsibility
            • Trademarks
            • Consumer Health Data Privacy Policy
            Our Portfolio Plus Icon Minus Icon
            • Thermo Scientific
            • Applied Biosystems
            • Invitrogen
            • Gibco
            • Ion Torrent
            • Fisher Scientific
            • Unity Lab Services
            • Patheon
            • PPD
            • Terms & Conditions
            • Privacy Information Center
            • Price & Freight Policy
            • Cookie Preferences

              Your choices regarding cookies on this site

              We and our affiliates and vendors use cookies and similar technologies to operate our sites, recognize visitors to our sites, provide secure log-in, collect statistics to optimize site functionality, and deliver content tailored to your interests. Click Accept All to accept all cookies and go directly to the site, click Reject All to reject all but cookies strictly necessary to the functioning of this site (required cookies), or click on Manage Settings to see detailed descriptions of the types of cookies and choose whether to accept certain cookies while on the site.
            © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
            United States flag icon
            United States

            Your items have has been added!


            Host server : magellan-search-green-6ff95d844f-rcq5x:80/100.66.72.122:80.
            git-commit: f44aa9153aef922f8fad9a05e87b8aee811da128
            git-url: https://github.com/thermofisher/magellan-search
            git-branch: release/2.28.0-Offline