Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTTATTTCTCTCTAAACGACAACT[C/G]GGCAAGGGCAGATGGACACTGCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605341 | ||||||||||||||||||||
Literature Links: |
PILRA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PILRA - paired immunoglobin like type 2 receptor alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZCWPW1 - zinc finger CW-type and PWWP domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258008.1 | Intron | NP_001244937.1 | ||||
NM_017984.4 | Intron | NP_060454.3 | ||||
XM_005250479.2 | Intron | XP_005250536.1 | ||||
XM_005250480.2 | Intron | XP_005250537.1 | ||||
XM_006716035.3 | Intron | XP_006716098.1 | ||||
XM_006716036.2 | Intron | XP_006716099.1 | ||||
XM_006716037.3 | Intron | XP_006716100.1 | ||||
XM_006716038.3 | Intron | XP_006716101.1 | ||||
XM_006716040.3 | Intron | XP_006716103.1 | ||||
XM_017012379.1 | Intron | XP_016867868.1 | ||||
XM_017012380.1 | Intron | XP_016867869.1 |