Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGTATCCTTCAAGTATTGCATC[A/G]GACAGCTCTGTAGCCTGACAAGAAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609855 MIM: 616498 MIM: 602976 MIM: 608665 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COASY PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COASY - Coenzyme A synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM134C - family with sequence similarity 134 member C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLX - MLX, MAX dimerization protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_170607.2 | 697 | UTR 3 | NP_733752.1 | |||
NM_198204.1 | 697 | UTR 3 | NP_937847.1 | |||
NM_198205.1 | 697 | UTR 3 | NP_937848.1 | |||
XM_017024991.1 | 697 | Intron | XP_016880480.1 |
PSMC3IP - PSMC3 interacting protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256014.1 | 697 | Silent Mutation | TCC,TCT | S,S 121 | NP_001242943.1 | |
NM_001256015.1 | 697 | Silent Mutation | TCC,TCT | S,S 105 | NP_001242944.1 | |
NM_001256016.1 | 697 | Silent Mutation | TCC,TCT | S,S 105 | NP_001242945.1 | |
NM_013290.6 | 697 | Silent Mutation | TCC,TCT | S,S 172 | NP_037422.2 | |
NM_016556.3 | 697 | Silent Mutation | TCC,TCT | S,S 184 | NP_057640.1 |