Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCCGCAGGGCGCGGCAAGATGGA[A/G]GTGACGGGGGTGTCGGCACCCACGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616442 MIM: 180662 MIM: 601303 MIM: 613583 | ||||||||||||||||||||
Literature Links: |
OVOL3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
OVOL3 - ovo like zinc finger 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR2I - RNA polymerase II subunit I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006233.4 | 581 | Intron | NP_006224.1 |
TBCB - tubulin folding cofactor B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281.2 | 581 | Silent Mutation | GAA,GAG | E,E 2 | NP_001272.2 | |
NM_001300971.1 | 581 | Intron | NP_001287900.1 |
WDR62 - WD repeat domain 62 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |