Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACCCACGGTGGGGATCATGTCCTC[A/G]TTGAACTGTCCTGACTGGAAAGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 616597 MIM: 176889 | ||||||||||||||||||||
Literature Links: |
ARL8A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL8A - ADP ribosylation factor like GTPase 8A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256129.1 | 309 | Silent Mutation | AAC,AAT | N,N 46 | NP_001243058.1 | |
NM_138795.3 | 309 | Silent Mutation | AAC,AAT | N,N 46 | NP_620150.1 |
GPR37L1 - G protein-coupled receptor 37 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPN7 - protein tyrosine phosphatase, non-receptor type 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |