Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
AGTGGGAGGTTTCAACGGGTGCACG[C/T]ACATCACTATTGCTGCAGATTTGGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 147265 | |||||||||||||||||||||||
Literature Links: |
ITPR1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ITPR1 - inositol 1,4,5-trisphosphate receptor type 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099952.2 | Intron | NP_001093422.2 | ||||
NM_001168272.1 | Intron | NP_001161744.1 | ||||
NM_002222.5 | Intron | NP_002213.5 | ||||
XM_005265109.2 | Intron | XP_005265166.1 | ||||
XM_005265110.2 | Intron | XP_005265167.1 | ||||
XM_006713131.2 | Intron | XP_006713194.1 | ||||
XM_011533681.1 | Intron | XP_011531983.1 | ||||
XM_011533682.2 | Intron | XP_011531984.1 | ||||
XM_011533683.2 | Intron | XP_011531985.1 | ||||
XM_011533684.1 | Intron | XP_011531986.1 | ||||
XM_011533685.1 | Intron | XP_011531987.1 | ||||
XM_011533686.1 | Intron | XP_011531988.1 | ||||
XM_011533687.1 | Intron | XP_011531989.1 | ||||
XM_011533688.1 | Intron | XP_011531990.1 | ||||
XM_011533690.1 | Intron | XP_011531992.1 | ||||
XM_011533691.1 | Intron | XP_011531993.1 | ||||
XM_011533692.2 | Intron | XP_011531994.1 | ||||
XM_017006357.1 | Intron | XP_016861846.1 | ||||
XM_017006358.1 | Intron | XP_016861847.1 |
ITPR1-AS1 - ITPR1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |