Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
TCTTGCACCAGCATCTCCACGATCT[A/G]CTCCTTGGTGCGGATGTCAGGCCGC
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 610335 MIM: 610416 | ||||||||||||||||||||||||||
Literature Links: |
CNBD2 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
CNBD2 - cyclic nucleotide binding domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001207076.2 | 670 | Intron | NP_001194005.1 | |||
NM_001304367.1 | 670 | Intron | NP_001291296.1 | |||
NM_080834.3 | 670 | Intron | NP_543024.2 | |||
XM_005260295.2 | 670 | Intron | XP_005260352.1 | |||
XM_011528590.2 | 670 | Intron | XP_011526892.1 | |||
XM_011528592.1 | 670 | Intron | XP_011526894.1 | |||
XM_011528593.2 | 670 | Intron | XP_011526895.1 | |||
XM_011528598.1 | 670 | Intron | XP_011526900.1 | |||
XM_017027683.1 | 670 | Intron | XP_016883172.1 |
PHF20 - PHD finger protein 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAND1 - SCAN domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016558.3 | 670 | Nonsense Mutation | CAG,TAG | Q,* 146 | NP_057642.1 | |
NM_033630.2 | 670 | Nonsense Mutation | CAG,TAG | Q,* 209 | NP_361012.2 |