Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGACAGCGATAGTGGCAGCAGCGG[G/T]GGCAGCGAGAGCTATGCGGGGCCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614647 MIM: 603162 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COQ6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COQ6 - coenzyme Q6, monooxygenase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182476.2 | 146 | Intron | NP_872282.1 | |||
NM_182480.2 | 146 | UTR 5 | NP_872286.2 | |||
XM_006720156.1 | 146 | Intron | XP_006720219.1 | |||
XM_011536807.1 | 146 | Intron | XP_011535109.1 | |||
XM_011536808.1 | 146 | Intron | XP_011535110.1 | |||
XM_011536809.2 | 146 | UTR 5 | XP_011535111.1 | |||
XM_011536810.2 | 146 | Intron | XP_011535112.1 | |||
XM_017021351.1 | 146 | Intron | XP_016876840.1 | |||
XM_017021352.1 | 146 | Intron | XP_016876841.1 |
ENTPD5 - ectonucleoside triphosphate diphosphohydrolase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM161B - family with sequence similarity 161 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152445.2 | 146 | Missense Mutation | NP_689658.2 | |||
XM_011536475.1 | 146 | Missense Mutation | XP_011534777.1 |