Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CCAGAGGGGTCTGGGAGGAGGCTGA[A/G]ATCACCTGATAGAAGGTATAGTTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602123 MIM: 603268 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAMK2G PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CAMK2G - calcium/calmodulin dependent protein kinase II gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDST2 - N-deacetylase and N-sulfotransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003635.3 | 3003 | Silent Mutation | ATC,ATT | I,I 733 | NP_003626.1 | |
XM_005270255.3 | 3003 | Silent Mutation | ATC,ATT | I,I 733 | XP_005270312.1 | |
XM_005270256.3 | 3003 | Silent Mutation | ATC,ATT | I,I 359 | XP_005270313.1 | |
XM_011540310.2 | 3003 | Silent Mutation | ATC,ATT | I,I 733 | XP_011538612.1 | |
XM_017016857.1 | 3003 | Silent Mutation | ATC,ATT | I,I 256 | XP_016872346.1 |
ZSWIM8 - zinc finger SWIM-type containing 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSWIM8-AS1 - ZSWIM8 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |