Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACATGTCTGGCGGGCAGGCAGAGA[C/T]GCTGCTGCAGGCCAAGGGCGAGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615140 MIM: 612093 MIM: 612092 MIM: 176883 | ||||||||||||||||||||
Literature Links: |
C12orf57 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C12orf57 - chromosome 12 open reading frame 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369635 - uncharacterized LOC105369635 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR141 - microRNA 141 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR200C - microRNA 200c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPN6 - protein tyrosine phosphatase, non-receptor type 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002831.5 | 520 | Missense Mutation | ACG,ATG | T,M 122 | NP_002822.2 | |
NM_080548.4 | 520 | Missense Mutation | ACG,ATG | T,M 124 | NP_536858.1 | |
NM_080549.3 | 520 | Missense Mutation | ACG,ATG | T,M 122 | NP_536859.1 | |
XM_006718994.1 | 520 | Missense Mutation | ACG,ATG | T,M 8 | XP_006719057.1 | |
XM_011520988.1 | 520 | Missense Mutation | ACG,ATG | T,M 124 | XP_011519290.1 |