Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGTACTGCTGCCGAAGTTGCCCCA[G/T]TTCCATGGGGTTCGTGTCTTTGGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606092 MIM: 610074 MIM: 610049 | ||||||||||||||||||||
Literature Links: |
DNAJC14 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNAJC14 - DnaJ heat shock protein family (Hsp40) member C14 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032364.5 | 515 | Intron | NP_115740.5 |
ORMDL2 - ORMDL sphingolipid biosynthesis regulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014182.4 | 515 | Missense Mutation | CAG,CAT | Q,H 141 | NP_054901.1 |
SARNP - SAP domain containing ribonucleoprotein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM198B - transmembrane protein 198B (pseudogene) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |