Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CTGCTTTGAAACGCGAGCACTTCCA[C/G]GTTCTGGTGAGGATCCGAGGAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608945 | ||||||||||||||||||||
Literature Links: |
FREM2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FREM2 - FRAS1 related extracellular matrix protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207361.5 | 1221 | Missense Mutation | CAC,CAG | H,Q 304 | NP_997244.4 | |
XM_017020554.1 | 1221 | Missense Mutation | CAC,CAG | H,Q 304 | XP_016876043.1 |
LINC00437 - long intergenic non-protein coding RNA 437 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |