Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTAGGACAGCATGGACTGCTGCA[C/T]GGCCTTCTGCAGCGACTGCCGCGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606272 MIM: 602836 MIM: 616484 | ||||||||||||||||||||
Literature Links: |
CTNS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTNS - cystinosin, lysosomal cystine transporter | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031681.2 | 505 | Intron | NP_001026851.2 | |||
NM_004937.2 | 505 | Intron | NP_004928.2 | |||
XM_005256485.2 | 505 | Intron | XP_005256542.1 | |||
XM_006721463.2 | 505 | Intron | XP_006721526.1 | |||
XM_006721464.2 | 505 | Intron | XP_006721527.1 | |||
XM_011523691.2 | 505 | Intron | XP_011521993.1 | |||
XM_011523692.2 | 505 | Intron | XP_011521994.1 | |||
XM_017024254.1 | 505 | Intron | XP_016879743.1 | |||
XM_017024255.1 | 505 | Intron | XP_016879744.1 | |||
XM_017024256.1 | 505 | Intron | XP_016879745.1 | |||
XM_017024257.1 | 505 | Intron | XP_016879746.1 | |||
XM_017024258.1 | 505 | Intron | XP_016879747.1 |
EMC6 - ER membrane protein complex subunit 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RX5 - purinergic receptor P2X 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RX5-TAX1BP3 - P2RX5-TAX1BP3 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAX1BP3 - Tax1 binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204698.1 | 505 | Missense Mutation | NP_001191627.1 | |||
NM_014604.3 | 505 | Missense Mutation | NP_055419.1 |