Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

SNP Genotyping
  • Search All
  • Popular Product Areas
  • TaqMan Assays
  • Gene Expression
  • Microbe & ABR Detection
  • Copy Number Variation
  • Mutation Detection
  • miRNA
  • SNP Genotyping
  • Primary Antibodies
  • Secondary Antibodies
  • Isotype Controls
  • Proteins & Peptides
  • ELISA Kits
  • All Documents & Support
  • Certificates
  • SDS
  • Manuals & Protocols
  • Product FAQs
    Search button Close
            • Order Status
            • Quick Order
            • Sign in
              Sign in
              Don't have an account ? Create Account
              • Account
              • Check Order Status
              • Aspire Member Program
              • Connect: Lab, Data, Apps
              • Custom Products & Projects
              • Services Central
            This product has been added to your favorites list. Go to My Favorites

            System Message

            OKCancel
            LOADING ...
            • Home
            • › Search Tool
            • › Search Results
            • › C_305000833_10
            See other CRH GT Assays ›
            SNP ID:
            rs561061658
            Gene
            CRH TRIM55
            Gene Name
            corticotropin releasing hormone
            tripartite motif containing 55
            Set Membership:
            -
            Chromosome Location:
            Chr.8: 66179013 - 66179013 on Build GRCh38
            Polymorphism:
            C/A, Transversion substitution
            Context Sequence [VIC/FAM]:

            CTAGAGACAGAGTCCCACCATCTTT[C/A]TGCCTGGAAAAGAATGAAGCATCAG

            Assay ID C_305000833_10
            Size
            Availability Made To Order
            Catalog # 4351379
            Price (USD) 442.00
            Your Price
            Online offer (USD):407.65
            407.65
            Check your price ›
            • Genomic Map
            • Assay Details
            • More Information

            Genomic Map

            LOADING... Map not Avaialable.
            ×
            Created with Raphaël 2.1.2Map Not Available.
            Back To Top

            Assay Details



            Species:

            Human

            dbSNP Submissions:

            NA

            Phenotype:

            MIM: 122560 MIM: 606469

            Literature Links:

            CRH PubMed Links

            Allele Nomenclature:

            Minor Allele Frequency:

            1000Genome Applied Biosystems® HapMap
            Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
            EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
            SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
            AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
            EUR - Not Available
            AMR - Not Available
            CRH - corticotropin releasing hormone
            Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
            NM_000756.3 Intron NP_000747.1
            XM_017013090.1 Intron XP_016868579.1
            XM_017013091.1 Intron XP_016868580.1
            XM_017013092.1 Intron XP_016868581.1
            XM_017013093.1 Intron XP_016868582.1
            TRIM55 - tripartite motif containing 55
            There are no transcripts associated with this gene.

            Back To Top

            More Information


            Panther Classification:

            Molecular Function -

            peptide hormone

            Gene Ontology Categories:

            Function(s) Process(es)

            positive regulation of protein phosphorylation
            synaptic transmission, dopaminergic
            glucocorticoid biosynthetic process
            inflammatory response
            signal transduction
            chemical synaptic transmission
            female pregnancy
            parturition
            learning or memory
            positive regulation of cell proliferation
            associative learning
            hormone-mediated apoptotic signaling pathway
            positive regulation of gene expression
            negative regulation of gene expression
            negative regulation of norepinephrine secretion
            positive regulation of circadian sleep/wake cycle, wakefulness
            positive regulation of cell death
            regulation of serotonin secretion
            diterpenoid metabolic process
            hypothalamus development
            lung development
            adrenal gland development
            positive regulation of cAMP biosynthetic process
            negative regulation of epinephrine secretion
            negative regulation of luteinizing hormone secretion
            locomotory exploration behavior
            positive regulation of insulin secretion involved in cellular response to glucose stimulus
            response to immobilization stress
            negative regulation of circadian sleep/wake cycle, REM sleep
            response to drug
            response to estrogen
            response to ethanol
            response to ether
            negative regulation of blood pressure
            response to pain
            ion homeostasis
            response to corticosterone
            positive regulation of corticotropin secretion
            positive regulation of cortisol secretion
            long-term synaptic potentiation
            positive regulation of digestive system process
            negative regulation of cell death
            negative regulation of glucagon secretion
            cellular response to cocaine
            cellular response to dexamethasone stimulus
            positive regulation of calcium ion import
            regulation of N-methyl-D-aspartate selective glutamate receptor activity
            positive regulation of corticosterone secretion
            positive regulation of behavioral fear response
            receptor binding
            hormone activity
            neuropeptide hormone activity
            protein binding
            corticotropin-releasing hormone activity
            corticotropin-releasing hormone receptor 1 binding
            corticotropin-releasing hormone receptor 2 binding

            Back To Top

            Related Products

            • TaqMan® Genotyping Master Mix
            Ordering Plus Icon Minus Icon
            • Order Status
            • Order Help
            • Quick Order
            • Supply Center
            • eProcurement
            Support Plus Icon Minus Icon
            • Help and Support
            • Contact Us
            • Technical Support Centers
            • Documents and Certificates
            • Report a Site Issue
            Resources Plus Icon Minus Icon
            • Learning Centers
            • Promotions
            • Events and Webinars
            • Social Media
            About Thermo Fisher Plus Icon Minus Icon
            • About Us
            • Careers
            • Investors
            • News
            • Social Responsibility
            • Trademarks
            • Consumer Health Data Privacy Policy
            Our Portfolio Plus Icon Minus Icon
            • Thermo Scientific
            • Applied Biosystems
            • Invitrogen
            • Gibco
            • Ion Torrent
            • Fisher Scientific
            • Unity Lab Services
            • Patheon
            • PPD
            • Terms & Conditions
            • Privacy Information Center
            • Price & Freight Policy
            • Cookie Preferences

              Your choices regarding cookies on this site

              We and our affiliates and vendors use cookies and similar technologies to operate our sites, recognize visitors to our sites, provide secure log-in, collect statistics to optimize site functionality, and deliver content tailored to your interests. Click Accept All to accept all cookies and go directly to the site, click Reject All to reject all but cookies strictly necessary to the functioning of this site (required cookies), or click on Manage Settings to see detailed descriptions of the types of cookies and choose whether to accept certain cookies while on the site.
            © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
            United States flag icon
            United States

            Your items have has been added!


            Host server : magellan-search-green-6ff95d844f-th92v:80/100.66.79.146:80.
            git-commit: f44aa9153aef922f8fad9a05e87b8aee811da128
            git-url: https://github.com/thermofisher/magellan-search
            git-branch: release/2.28.0-Offline