Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTGACCCTCCCCGACCTCCAGGG[A/C]AGACTCCAACCCCCAGGCTCACATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600673 | ||||||||||||||||||||
Literature Links: |
ATXN7L3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATXN7L3 - ataxin 7 like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101926967 - uncharacterized LOC101926967 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6782 - microRNA 6782 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBTF - upstream binding transcription factor, RNA polymerase I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001076683.1 | Intron | NP_001070151.1 | ||||
NM_001076684.2 | Intron | NP_001070152.1 | ||||
NM_014233.3 | Intron | NP_055048.1 | ||||
XM_006722059.3 | Intron | XP_006722122.1 | ||||
XM_006722060.2 | Intron | XP_006722123.1 | ||||
XM_006722061.2 | Intron | XP_006722124.1 | ||||
XM_017024995.1 | Intron | XP_016880484.1 | ||||
XM_017024996.1 | Intron | XP_016880485.1 | ||||
XM_017024997.1 | Intron | XP_016880486.1 | ||||
XM_017024998.1 | Intron | XP_016880487.1 | ||||
XM_017024999.1 | Intron | XP_016880488.1 | ||||
XM_017025000.1 | Intron | XP_016880489.1 | ||||
XM_017025001.1 | Intron | XP_016880490.1 | ||||
XM_017025002.1 | Intron | XP_016880491.1 | ||||
XM_017025003.1 | Intron | XP_016880492.1 | ||||
XM_017025004.1 | Intron | XP_016880493.1 |