Save up to 31% on select cell culture essentials

Bundle and save

Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

SNP Genotyping
  • Search All
  • Popular Product Areas
  • TaqMan Assays
  • Gene Expression
  • Microbe & ABR Detection
  • Copy Number Variation
  • Mutation Detection
  • miRNA
  • SNP Genotyping
  • Primary Antibodies
  • Secondary Antibodies
  • Isotype Controls
  • Proteins & Peptides
  • ELISA Kits
  • All Documents & Support
  • Certificates
  • SDS
  • Manuals & Protocols
  • Product FAQs
    Search button Close
            • Order Status
            • Quick Order
            • Sign in
              Sign in
              Don't have an account ? Create Account
              • Account
              • Check Order Status
              • Aspire Member Program
              • Connect: Lab, Data, Apps
              • Custom Products & Projects
              • Services Central
            This product has been added to your favorites list. Go to My Favorites

            System Message

            OKCancel
            LOADING ...
            • Home
            • › Search Tool
            • › Search Results
            • › C__26725629_10
            See other ALDOA GT Assays ›
            SNP ID:
            rs9928448
            Gene
            ALDOA FAM57B
            Gene Name
            aldolase, fructose-bisphosphate A
            family with sequence similarity 57 member B
            Set Membership:
            > HapMap
            Chromosome Location:
            Chr.16: 30061209 - 30061209 on Build GRCh38
            Polymorphism:
            T/C, Transition substitution
            Context Sequence [VIC/FAM]:

            TGGATAGACCAGTTCTCCCTTCTTG[T/C]CTCTAAGGACACGCTGCTCCTATTC

            Assay ID C__26725629_10
            Size
            Availability Made To Order
            Catalog # 4351379
            Price
            Your Price
            Online offer:
            Check your price ›
            • Genomic Map
            • Assay Details
            • More Information

            Genomic Map

            LOADING... Fetching data..
            ×
            Back To Top

            Assay Details



            Species:

            Human

            dbSNP Submissions:

            NA

            Phenotype:

            MIM: 103850 MIM: 615175

            Literature Links:

            ALDOA PubMed Links

            Allele Nomenclature:

            Minor Allele Frequency:

            1000Genome Applied Biosystems® HapMap
            Global
            C (0.49)
            (0.51)
            Caucasian - Not Available CEPH (CEU)
            C (0.49)
            (0.51)
            EAS
            C (0.37)
            (0.63)
            African American - Not Available YRI (Yoruba)
            T (0.35)
            (0.65)
            SAS
            C (0.48)
            (0.52)
            Chinese - Not Available JPT (Japanese)
            C (0.27)
            (0.73)
            AFR
            T (0.36)
            (0.64)
            Japanese - Not Available CHB (Han Chinese)
            C (0.43)
            (0.57)
            EUR
            C (0.47)
            (0.53)
            AMR
            C (0.41)
            (0.59)
            ALDOA - aldolase, fructose-bisphosphate A
            Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
            NM_000034.3 Intron NP_000025.1
            NM_001127617.2 Intron NP_001121089.1
            NM_001243177.1 Intron NP_001230106.1
            NM_184041.2 Intron NP_908930.1
            NM_184043.2 Intron NP_908932.1
            XM_011545768.2 Intron XP_011544070.1
            FAM57B - family with sequence similarity 57 member B
            There are no transcripts associated with this gene.

            Back To Top

            More Information


            Set Membership:

            HapMap

            Panther Classification:

            Molecular Function -

            aldolase

            Gene Ontology Categories:

            Function(s) Process(es)

            platelet degranulation
            fructose metabolic process
            gluconeogenesis
            glycolytic process
            ATP biosynthetic process
            striated muscle contraction
            actin filament organization
            regulation of cell shape
            fructose 1,6-bisphosphate metabolic process
            muscle cell cellular homeostasis
            protein homotetramerization
            canonical glycolysis
            cell-cell adhesion
            actin binding
            fructose-bisphosphate aldolase activity
            protein binding
            cytoskeletal protein binding
            tubulin binding
            identical protein binding
            poly(A) RNA binding
            fructose binding
            cadherin binding involved in cell-cell adhesion

            Back To Top

            Related Products

            • TaqMan® Genotyping Master Mix
            Ordering Plus Icon Minus Icon
            • Order Status
            • Order Help
            • Quick Order
            • Supply Center
            • eProcurement
            Support Plus Icon Minus Icon
            • Help and Support
            • Contact Us
            • Technical Support Centers
            • Documents and Certificates
            • Report a Site Issue
            Resources Plus Icon Minus Icon
            • Learning Centers
            • Promotions
            • Events and Webinars
            • Social Media
            About Thermo Fisher Plus Icon Minus Icon
            • About Us
            • Careers
            • Investors
            • News
            • Social Responsibility
            • Trademarks
            • Consumer Health Data Privacy Policy
            Our Portfolio Plus Icon Minus Icon
            • Thermo Scientific
            • Applied Biosystems
            • Invitrogen
            • Gibco
            • Ion Torrent
            • Fisher Scientific
            • Unity Lab Services
            • Patheon
            • PPD
            • Terms & Conditions
            • Privacy Information Center
            • Price & Freight Policy
            • Cookie Preferences

              Your choices regarding cookies on this site

              We and our affiliates and vendors use cookies and similar technologies to operate our sites, recognize visitors to our sites, provide secure log-in, collect statistics to optimize site functionality, and deliver content tailored to your interests. Click Accept All to accept all cookies and go directly to the site, click Reject All to reject all but cookies strictly necessary to the functioning of this site (required cookies), or click on Manage Settings to see detailed descriptions of the types of cookies and choose whether to accept certain cookies while on the site.
            © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
            United States flag icon
            United States

            Your items have has been added!


            Host server : magellan-search-green-6ff95d844f-2fn6k:80/100.66.79.97:80.
            git-commit: f44aa9153aef922f8fad9a05e87b8aee811da128
            git-url: https://github.com/thermofisher/magellan-search
            git-branch: release/2.28.0-Offline