Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCCAAGCCGCCCAGCCTTCCGA[C/T]GCACAGCATTCTAGCACCAGAGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614148 MIM: 602241 | ||||||||||||||||||||
Literature Links: |
C1QTNF9B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1QTNF9B - C1q and tumor necrosis factor related protein 9B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C1QTNF9B-AS1 - C1QTNF9B antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014442.2 | 138 | Intron | NP_001014442.2 | |||
NM_001135816.1 | 138 | Intron | NP_001129288.1 |
MIPEP - mitochondrial intermediate peptidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005932.3 | 138 | Missense Mutation | NP_005923.2 | |||
XM_011535097.2 | 138 | Intron | XP_011533399.1 | |||
XM_011535098.2 | 138 | Missense Mutation | XP_011533400.1 |