Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTGCATCTGTGGCTGGAAGGCTC[A/C]CCACTCATTCCAGTGCCGGAAGTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123631 MIM: 600929 MIM: 603126 | ||||||||||||||||||||
Literature Links: |
CRYBA4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CRYBA4 - crystallin beta A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CRYBB1 - crystallin beta B1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001887.3 | 728 | Nonsense Mutation | GGA,TGA | G,* 220 | NP_001878.1 | |
XM_011529899.2 | 728 | Nonsense Mutation | GGA,TGA | G,* 220 | XP_011528201.1 |
TPST2 - tyrosylprotein sulfotransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |