Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACCCGGTGGTGCCAGGAGCCTCA[A/G]GCTTGGACCATACCCATGGCCGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603559 MIM: 603696 | ||||||||||||||||||||
Literature Links: |
MTMR4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MTMR4 - myotubularin related protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEPT4 - septin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198713.1 | 875 | Intron | NP_001185642.1 | |||
NM_001256782.1 | 875 | Intron | NP_001243711.1 | |||
NM_001256822.1 | 875 | Intron | NP_001243751.1 | |||
NM_004574.4 | 875 | Intron | NP_004565.1 | |||
NM_080415.3 | 875 | Silent Mutation | CTG,TTG | L,L 252 | NP_536340.1 | |
NM_080416.3 | 875 | Intron | NP_536341.1 | |||
XM_006721949.2 | 875 | Intron | XP_006722012.1 | |||
XM_006721950.3 | 875 | Intron | XP_006722013.1 | |||
XM_006721951.2 | 875 | Intron | XP_006722014.1 | |||
XM_006721952.2 | 875 | Intron | XP_006722015.1 | |||
XM_006721954.2 | 875 | Intron | XP_006722017.1 | |||
XM_006721955.2 | 875 | Intron | XP_006722018.1 | |||
XM_011524911.1 | 875 | Intron | XP_011523213.1 | |||
XM_011524912.1 | 875 | Intron | XP_011523214.1 |
SEPT4-AS1 - SEPT4 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |