Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGTGATCACCTTGTCTCCTTTTA[C/T]AAGACAGACCTCACTCGGTAAAAAT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615746 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CFAP100 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CFAP100 - cilia and flagella associated protein 100 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182628.2 | 3231 | Intron | NP_872434.2 | |||
XM_006713623.2 | 3231 | Intron | XP_006713686.1 | |||
XM_017006320.1 | 3231 | Intron | XP_016861809.1 | |||
XM_017006321.1 | 3231 | Intron | XP_016861810.1 | |||
XM_017006322.1 | 3231 | Intron | XP_016861811.1 | |||
XM_017006323.1 | 3231 | Intron | XP_016861812.1 | |||
XM_017006324.1 | 3231 | Intron | XP_016861813.1 | |||
XM_017006325.1 | 3231 | Intron | XP_016861814.1 | |||
XM_017006326.1 | 3231 | Intron | XP_016861815.1 | |||
XM_017006327.1 | 3231 | Intron | XP_016861816.1 |
LOC105374089 - uncharacterized LOC105374089 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZXDC - ZXD family zinc finger C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040653.3 | 3231 | Intron | NP_001035743.1 | |||
NM_025112.4 | 3231 | Intron | NP_079388.3 | |||
XM_005247757.3 | 3231 | Intron | XP_005247814.1 | |||
XM_006713741.2 | 3231 | UTR 3 | XP_006713804.1 | |||
XM_011513119.2 | 3231 | UTR 3 | XP_011511421.1 |
Set Membership: |
HapMap |