Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAGGGCATTGCGGAGGGCATTGG[A/G]CCTCCCCACCCACTACAGTTAACTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142954 MIM: 142951 MIM: 142950 MIM: 142956 | ||||||||||||||||||||
Literature Links: |
HOXA-AS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HOXA-AS3 - HOXA cluster antisense RNA 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA10-HOXA9 - HOXA10-HOXA9 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA3 - homeobox A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030661.4 | 1875 | Intron | NP_109377.1 | |||
NM_153631.2 | 1875 | Intron | NP_705895.1 |
HOXA6 - homeobox A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA7 - homeobox A7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006896.3 | 1875 | UTR 3 | NP_008827.2 |
HOXA9 - homeobox A9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |