Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAAAACACCAGAGGGCGGTGGTC[C/T]CAGGTACAGGGAGGGGTGGGGGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604146 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LRRC10B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LRRC10B - leucine rich repeat containing 10B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4488 - microRNA 4488 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYT7 - synaptotagmin 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252065.1 | 6069 | UTR 3 | NP_001238994.1 | |||
NM_001300773.1 | 6069 | UTR 3 | NP_001287702.1 | |||
NM_004200.3 | 6069 | UTR 3 | NP_004191.2 | |||
XM_005274383.4 | 6069 | Intron | XP_005274440.1 | |||
XM_005274384.2 | 6069 | Intron | XP_005274441.1 | |||
XM_005274385.4 | 6069 | Intron | XP_005274442.1 | |||
XM_005274387.4 | 6069 | Intron | XP_005274444.1 | |||
XM_005274390.4 | 6069 | Intron | XP_005274447.1 | |||
XM_006718736.3 | 6069 | Intron | XP_006718799.1 | |||
XM_011545335.2 | 6069 | Intron | XP_011543637.1 | |||
XM_011545336.2 | 6069 | Intron | XP_011543638.1 | |||
XM_011545337.2 | 6069 | Intron | XP_011543639.1 | |||
XM_011545338.2 | 6069 | Intron | XP_011543640.1 | |||
XM_011545339.2 | 6069 | Intron | XP_011543641.1 | |||
XM_011545340.2 | 6069 | Intron | XP_011543642.1 | |||
XM_011545341.2 | 6069 | Intron | XP_011543643.1 | |||
XM_011545342.2 | 6069 | Intron | XP_011543644.1 | |||
XM_011545343.2 | 6069 | Intron | XP_011543645.1 |