Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCATCTTGTGCCTGCTCAGGGCC[A/C]TGCCCTAACCCAGGGCTGGGCTCGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600856 MIM: 602631 MIM: 603240 | ||||||||||||||||||||
Literature Links: |
CDKN1C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDKN1C - cyclin dependent kinase inhibitor 1C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC22A18 - solute carrier family 22 member 18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC22A18AS - solute carrier family 22 member 18 antisense | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302862.1 | 646 | Intron | NP_001289791.1 | |||
NM_007105.3 | 646 | Intron | NP_009036.2 | |||
XM_017017832.1 | 646 | Intron | XP_016873321.1 | |||
XM_017017833.1 | 646 | Intron | XP_016873322.1 | |||
XM_017017834.1 | 646 | Intron | XP_016873323.1 | |||
XM_017017835.1 | 646 | UTR 5 | XP_016873324.1 | |||
XM_017017836.1 | 646 | Intron | XP_016873325.1 |