Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAAAGAGGGCAAGTCTCCAGCTGC[A/G]TGGCTGATTATGACACAGTAGAAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
CNOT11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNOT11 - CCR4-NOT transcription complex subunit 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF149 - ring finger protein 149 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173647.3 | 1993 | Intron | NP_775918.2 | |||
XM_005263920.2 | 1993 | Intron | XP_005263977.1 | |||
XM_005263921.3 | 1993 | UTR 3 | XP_005263978.1 | |||
XM_011510990.2 | 1993 | Intron | XP_011509292.1 |
SNORD89 - small nucleolar RNA, C/D box 89 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |