Invitrogen TrueDesign Genome Editor

Genome editing, simplified

The Invitrogen TrueDesign Genome Editor is a free online tool that enables scientists of all experience levels to easily design, select, and order reagents for accurate and successful gene editing experiments. 

 

Experiment types supported by the TrueDesign Genome Editor

Experiment type Knockout a target gene Add a fluorescent or epitope tag Insert, delete, or replace up to 30 bases Long insertion up to 10kb Generate a SNP
Description Insert a stop codon, target a region for indel formation, or utilize the TrueTag Knockout Enrichment Kit Tag a target gene with less time and effort with TrueTag Donor DNA Kits In any human, mouse, rat, zebrafish, or roundworm gene using CRISPR-Cas9 or TALEN technology sequences up to 10 kb with custom length homology arms up to 1 kb using CRISPR-Cas9 or TALEN technology Introduce a single nucleotide change in your target




User guides

Download workflow schematics

Indel frameshift

STOP codon

Gene tagging

SNP/insert/delete

We also offer pre-designed synthetic and lentiviral guide RNAs for straightforward knockout of your human or mouse target gene, plus easy online ordering of any custom synthetic sgRNA design.

With TrueDesign, you can:

  • Order and export your experimental designs with one click—design and add all reagents to your cart or download a comprehensive design report
  • Easily design genome editing experiments—from simple knockout to complex large donor knock-in experiments
  • Utilize genetic variation data for more variant aware gRNA design and off-target considerations
  • Design the most effective gRNAs for your experiments—using state of the art algorithms for on target and off-target considerations

The TrueDesign tool supports a variety of edits—gene knockout, gene tagging, insertion, replacement, deletion, and SNP creation. For each design, the software compiles a list of the materials you will need for a successful edit, with the convenience of ordering them from one source and the confidence that they will work together. Our research shows that improved design and delivery of gRNA, Cas9 nuclease, and donor DNA can contribute to enhanced CRISPR/Cas9-mediated genome editing.[1]


Access the tool in 2 easy steps

A Thermo Fisher Scientific account is required, but creating an account and/or signing in is free, quick, and easy. 

  1. Launch the TrueDesign Genome Editor
  2. Log in to the Thermo Fisher Connect Platform with your  user account

Don't have an account? Create one today with only your name and email. Other benefits include contracted pricing, online quotes, ability to place and track orders, and earning rewards.


How-to videos


TrueDesign Genome Editor software workflow

The TrueDesign tool follows a simple, three-step workflow: select your gene and transcript, specify your edit, and design your CRISPR and/or TALEN target from our recommendations. At the end, you’ll see a summary where you can review your design and download a list of materials needed or add them to your cart.

 

In this example, we’ll add a GFP tag to the N-terminus of the ACTB gene, which encodes the protein actin.

Sample data: GFP tagging

This experiment shows the results when the design developed in the extended Workflow example was carried out with U2OS cells, editing the ACTB gene to generate both N- and C-terminal GFP tags for the actin protein. Using the recommended gRNA design GCTATTCTCGCAGCTCACCA (PAM TGG), the forward and reverse primers were used with the TrueTag Donor DNA Kit to amplify a functional donor template. After successful amplification and purification of the donor DNA, it was cotransfected into cells with the gRNA and Cas9 protein.

 

The microscopy images show U2OS cells expressing GFP-tagged ACTB (green), counterstained with Hoechst nuclear dye (blue). The green actin filaments are clearly visible in the edited cells (B) vs negative controls (A). When puromycin selective pressure is applied to these cell pools, the population of cells can be driven to almost 100% as quantified by flow cytometry. A detailed workflow is described in the TrueTag Donor DNA Kit user guide.

Microscopic view of fluorescently labeled cells tagged at the ACTB gene using a TrueTag Donor DNA Kit

ACTB-tagged cells (green), counterstained with Hoechst dye (blue). (A) Negative control and (B) edited cells showing clear actin filament formation with GFP-ACTB fusion proteins. (C) Summary of three experiments where applying puromycin selection can drive these cell populations to >80% GFP-positive cells for the N-terminal constructs and >99% positive cells for the C-terminal constructs. Images were captured on the Invitrogen EVOS FL Color Imaging System.

Try the TrueDesign Genome Editor


Related products and tools

TrueGuide CRISPR Synthetic gRNA

Invitrogen TrueGuide gRNAs are pre-designed CRISPR sgRNAs designed with an algorithm that selects for high knockout efficiency with optimal specificity. Simply search for your gene!

 

Synthetic gRNA

TrueTag Donor DNA Kits

Invitrogen TrueTag Donor DNA Kits include all the necessary reagents to create donor DNA for fluorescent tags, epitope tags, or precise gene editing experiments.


 

TrueTag Donor DNA Kit includes four linear donor templates, Phusion Flash High-Fidelity PCR Master Mix, PCR cleanup columns and buffers and positive control primers to tag human beta-actin (ACTB)

SeqScreener Gene Edit Confirmation tool

The Applied Biosystems SeqScreener Gene Edit Confirmation App lets you screen and validate gene editing results from capillary electrophoresis Sanger sequencing and will determine the spectrum and frequency of targeted mutations in a pool of cells.

Teal icon of DNA indicating SeqScreener gene editing confirmation software tool

Resources, support and references

1x1 image pixel for data collection