T7 RNA Polymerase (20 U/μL)

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. ItRead more

Change view

Catalog Number	Concentration	Quantity
EP0111	20U/µL	5,000 units
EP0112	20U/µL	5 x 5,000 units

2 Options

Catalog number EP0111

Price (USD)

109.00

Each

In stock

Add to cart

Concentration:

20U/µL

Quantity:

5,000 units

Request bulk or custom format

Price (USD)

109.00

Each

Add to cart

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA

For Research Use Only. Not for use in diagnostic procedures.

Specifications

Concentration20U/µL

Quantity5,000 units

PolymeraseT7 RNA Polymerase

Unit SizeEach

This is an AI-powered search and may not always get things right. You can help us make it better with a thumbs up or down on individual answers or by selecting the “Give feedback" button. Your search history and customer login information may be retained by Thermo Fisher and processed in accordance with our Privacy Notice.

Frequently asked questions (FAQs)

What is the advantage of using TranscriptAid T7 High Yield Transcription Kit over Thermo Scientific T7 RNA Polymerase with a standard transcription buffer?

TranscriptAid T7 High Yield Transcription Kit is designed to produce both long and short transcripts for applications that require large yields of RNA (milligram amounts). The kit can achieve 10 times greater amount than from conventional in vitro transcription reactions with T7 RNA polymerase due to its unique proprietary enzyme and buffer formulations. Please note that TranscriptAid T7 High Yield Transcription Kit is not recommended for generation of radioactively labelled RNA. Due to large quantities of RNA synthesized with the kit, generation of high specific activity radiolabeled probes would require prohibitively large amounts of radiolabeled nucleotide.

Does the T7 RNA Polymerase (20 U/μl) (Cat. No. EP0111) contain a His-Tag which could be used for purification or conjugation?

The T7 RNA Polymerase (20 U/μl) (Cat. No. EP0111) does not contain a His-Tag, and currently none of our T7 RNA polymerases have a tag available for purification/conjugation.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.